iNat
iNaturalist
Observations
iNaturalist Research Grade Observations
Catalog #: 4742276
Taxon: Inocybe geophylla var. lilacina (Peck) Gillet
Family: Inocybaceae
Collector: alan_rockefeller      
Date: 2012-09-22
Verbatim Date: 2012-09-22
Locality: Mexico, Distrito Federal, Ajusco, Mexico, Mexico
19.19215  -99.2563 +-11062m.
Georeference Remarks: GEODETIC_DATUM_ASSUMED_WGS84
Description: Original observation #4742276 (iNaturalist)
Occurrence Remarks:

Under Abies religiosa.

ITS sequence:

ACCGGCTGTTTTATTTGCTNACTTTTNNAGAGCTCATGTGCACGCTTCAAAATCTTTGTCATTTCTCCAAANAGTGCACATACTGTAGACCTGAGGGGAGCAATGAATTTCCATTCGAGTTGGGGATTGCTGTGNTTAATTTAAAAAAAGTCGGCTTTCCCTTGTATTTTTTCAGGTCTATGTTGTTTTTCACAACCTCTATAACATGTTTAGAATGTTGAATTAAGGTCTTTGTACCTATATAAAAGTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGACCTTCTCAACCACATCGTTCTTGTTTTGAATGTGTGTGGCTTGGATGTGGGGGAATATTTTGCAGGCTTCAAAATCAAAGAAGTCGGCTCCCCTGAAATGCATTAGTGGTGTCTGAGCTGCTATTGGTGTGATAAATTATCTATGCCTTTGGTGATGCTGGTCAGCACTGCTTATAACGGACGGTGATCATTTGACAAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCAGCTCTTTGAACTGTCCGAGTTGTAATCTAAAGANGTGTTACCTGTGCTGGACCGTGTACAAGTCTCCTGA

Specimen Images
Rights Holder: © held by the observer (listed as 'Collector') at iNaturalist.org, with some rights reserved (CC BY-SA)
Record Id: c15bc2d0-a9b8-454b-8341-9f950165bec1
Occurrence ID (GUID): http://www.inaturalist.org/observations/4742276
For additional information on this occurrence, please contact: Ken-ichi Ueda (help@inaturalist.org)
No comments have been submitted
New Comment
Login to leave a comment.