iNat
iNaturalist
Observations
iNaturalist Research Grade Observations
Catalog #: 4749152
Taxon: Cortinarius caperatus (Pers.) Fr.
Family: Cortinariaceae
Collector: alan_rockefeller      
Date: 2016-03-20
Verbatim Date: 2016-03-20
Locality: United States, Alaska, Chugach State Forest, Cordova, Alaska, USA
60.552  -145.6395 +-15661m.
Georeference Remarks: GEODETIC_DATUM_ASSUMED_WGS84
Description: Original observation #4749152 (iNaturalist)
Occurrence Remarks:

Ryan Gaber collection.

Growing near Picea sitchensis, hemlock and alder.

ITS sequence: TGATGAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCGTCTTTATATTTCCACCTTGT
GCACCTTTTGTAGACCTGGATATCTCTCTGAATGCACACAAGCATTTGGGTTTGAGGGGTTGACTTTTTGGTCTCCCTTT
ATATTTCCAGGCCTATGTTTCTTTCATATACCCCACTTGTGTTATAGAATGTAATAAATGGGCCTTTGTGCCTGTAAAGC
TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGC
AGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAT
TAATATATCAACCTCCTCAACTTGTGTTGAGTGTTGGATGTGGGGGTTCTTTCTTTGCTGGCTTCACGGTCAGCTCCCCT
GAAATGCATTAGCGGAACAACCTGTTCACTGTTCATTGGCGTGATAACTATCTACGCTGCTTGTTGACAGTGAAGCAAGT
TCAGCTTCTAACAGTCCATTAAATTGGACAAATTTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTA
AGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGACAAGCTCAAATTT
AAAATCTGTCAGCCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTAATCCGCGCTGGAC

Specimen Images
Rights Holder: © held by the observer (listed as 'Collector') at iNaturalist.org, with some rights reserved (CC BY-SA)
Record Id: 8634fd5f-ceb5-4a3e-94cb-68877b87ef43
Occurrence ID (GUID): http://www.inaturalist.org/observations/4749152
For additional information on this occurrence, please contact: Ken-ichi Ueda (help@inaturalist.org)
No comments have been submitted
New Comment
Login to leave a comment.